Tadpoles raised in water with atrazine levels of 0.1 ppb should produce a higher percentage of male frogs with gonadal abnormalities than those raised in pure water.
This statement is an example of:

A. a question leading to a hypothesis
B. a hypothesis
C. a testable prediction leading to design of an experiment
D. data from an experiment
E. an interpretation of data

Answer:

The chromatid combinations present will be AmAm, CpCp and BpBp

Explanation:

In mitosis, there is no exchange of materials between homologous chromosomes, thus the paternal and the maternal member of chromosomes DO NOT exchange materials at all.

This simply yields chromatids combinations that are singly maternal as AmAm OR singly paternal as CpCp and BpBp

During metaphase in mitosis, the diploid cell will have the chromatid combinations AmAm, CpCp, and BpBp.

In mitosis, each pair of chromosomes duplicates itself resulting in two sister chromatids. These sister chromatids are identical copies of each other and are joined together at a point called the centromere. During metaphase, the chromosomes line up along the equator of the cell, and each sister chromatid is attached to a spindle fiber. In the given scenario, the diploid cell contains the following pairs of chromosomes: AA, BB, and CC. Therefore, during metaphase, the chromatid combinations present are:

https://brainly.com/question/31626745

#SPJ3

Answer:

B

Explanation:

Changing the pH of the binding reaction mixtures can have a dramatic effect on ligand-protein binding. Altering the pH of the reactions between warfarin (which binds to site IIA of HSA via hydrophobic interaction) or ibuprofen (which binds to site IIIa of HSA via an ionic interaction) and HSA is likely to Affect warfarin-HSA binding but not ibuprofen-HSA binding.

Answer:

B

Explanation:

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

Animalia: Eukaryotic multicellular heterotroph

Arachaebacteria: Prokaryotic unicellular

Eubacteria: Prokaryotic unicellular  

Fungi: Eukaryotic multicellular heterotroph

Plantae: Eukaryotic multicellular autotroph

Protista: Eukaryotic unicellular/multicellular auto/heterotroph

Explanation:

Living organisms of different kingdoms are classified according to their number of cells, type of nutrition and presence or absence of nucleus.

Unicellular: single celled organism; multicellular: organisms with multiple number of cells

Prokaryotic: absence of nucleus or membrane-bound cellular organelles. Eukaryotic: nucleus is present

Autotroph: Prepares their own food. Heterotroph: Depends on other organisms for food

Species belonging to Kingdom Animalia are eukaryotic, multicellular, heterotrophic, motile, reproduce sexually or asexually.

Species belonging to Kingdom Plantae are eukaryotic, multicellular, autotrophic, nonmotile, reproduce sexually or asexually.

Species belonging to Kingdom Protista are eukaryotic, unicellular or multicellular, and can be autotrophic or heterotrophic, reproduce sexually or asexually.

Species belonging to Kingdom Fungi are eukaryotic, multicellular (few are unicellular), heterotrophs – saprophytes or parasites

Species belonging to Kingdom Monera including arachaebacteria and eubacteria are prokaryotic unicellular organisms, reproduce asexually

The classification of living organisms is arranged in the order and they are listed below Archaebacteria, Eubacteria, Fungi, Protista, Plants, Animals.

Explanation:

1. Animals - Eukaryotic Multicellular Heterotroph

2. Plants - Eukaryotic Multicellular Autotroph

3. Fungi - Eukaryotic Unicellular/Multicellular Auto/Heterotroph

4. Protista - Eukaryotic Unicellular/Multicellular Auto/Heterotroph

5. Bacteria - Prokaryotic Unicellular

6. Archae - bacteria-Prokaryotic Unicellular

Answer with explanation:

Gibson Assembly is a method of molecular cloning which join multiple DNA fragments in a single reaction.  It was created by Daniel G. Gibson, Chief Technology Officer and co-founder of SGI-DNA. (See attached picture)

a. Role of Phusion DNA Polymerase

It bring the enzymes closer to DNA fragment and help enzymes to make PCR product with speed and more accurately. Moreover it has the ability of amplifying long templates. (See attached picture)

a. Role of T5 exonuclease

It is an exonuclease enzyme which means it remove the nucleotide from DNA stand in 5´ to 3´ direction. It create nicks in the double stranded DNA for the incorporation of other fragments. Furthermore, it also work fine in single stranded DNA. (See attached picture)

a. Role of Taq DNA ligase

It is a thermostable enzyme which catalyzes the phosphodiester bond formation between 5´-phosphate and the 3´-hydroxyl of two adjacent DNA strands. (See attached picture)

Answer:

1) Recursive definition: [tex]p_n = (50,000)3^n[/tex]

2) At the beginning of the 4th interval

Explanation:

1)

The initial population of the bacteria at time zero is

[tex]p_0 = 50,000[/tex]

Here we are told that the reading is taken every two hours; we call this time interval "n", so

[tex]n=2 h[/tex]

And also, after every time interval n, the number of bacteria has tripled.

This means that when n = 1,

[tex]p_1 = 3 p_0[/tex]

And when n=2,

[tex]p_2 = 3 p_1 = 3(3p_0)=9 p_0[/tex]

Applied recursively, we get

[tex]p_n = 3^n p_0[/tex]

And substituting p0,

[tex]p_n = (50,000)3^n[/tex] (1)

2)

Here we want to find at the beginning of which interval there are

[tex]p=1,350,000[/tex]

bacteria.

This means that we can rewrite eq.(1) as

[tex]1,350,000=(50,000)3^n[/tex]

By simplifying,

[tex]27=3^n[/tex]

Which means that

[tex]n=3[/tex]

However, this means that the number of bacteria is 1,350,000 after 3 time intervals; therefore, at the beginning of the 4th interval.

These have been sorted here:

The SMC (structural maintenance of chromosomes) proteins encompass two major complexes in eukaryotes: cohesins and condensins.

Cohesins maintain sister chromatid cohesion after replication until separation, associated with kleisin, and crucial for DNA replication and cell division.

Read more on DNA replication https://brainly.com/question/21265857

#SPJ3

Final answer:

Cohesins and condensins are SMC protein complexes essential for chromosome maintenance in cell division. Cohesins primarily hold sister chromatids together, while condensins contribute to chromosome compaction during mitosis. Both share structural features and are crucial for DNA replication and cell division.

Explanation:

The SMC (structural maintenance of chromosomes) proteins are crucial for the proper regulation of chromosome structure and segregation during cell division. Specifically, in eukaryotes, cohesins and condensins are two major complexes involved in chromosome maintenance. The function and structure of these complexes can be described by the following phrases:

Answer: Expected heterozygous genotype = 2×46 = 92

Explanation:

According to the hypothesis of segregation of paired genes in heterozygous F1 generation crosses produces 1:2:1 genotype ratio. This means that all these three possible genotypes should be produced in the F2 generation meaning that we have 1(Dominant homozygous) :2 (Dominant heterozygous): 1 (Recessive Homozygous).

Phenotypic ratio shared (dominant: recessive) = 154 and 46

If recessive homozygous phenotype = recessive homozygous genotype = 46

The expected dominant heterozygous genotype= 2 × (recessive homozygous genotype)

= 2 × 46 = 92

Answer:

The seafloor is only 180 million years old due to the process of subduction. The floor of the sea's tends to get colder and denser with the passage of time. At a certain time, the seafloor becomes so dense that it sinks in the upper mantle. The Earth's crust cannot undergo this process and hence has oldest rocks. We can say that the seafloor is less than 180 million years old because it is typically recycled back into the mantle of the Earth.

The oldest sea floor is only 180 million years old because new seafloor is constantly being created through seafloor spreading at mid-ocean ridges.

The reason that the oldest sea floor is only about 180 million years old, while the Earth is 4.6 billion years old, is because new seafloor is constantly being created through a process called seafloor spreading. This process occurs at mid-ocean ridges, where tectonic plates are moving apart.

As the plates separate, magma from the Earth's mantle rises and solidifies, forming new oceanic crust. Over time, this new crust moves away from the ridge and gets older, while new crust forms at the ridge. Therefore, the oldest sea floor is relatively young compared to the age of the Earth.

https://brainly.com/question/15122129

#SPJ3

Answer:

Includes all of the values embodied by the ecosystem, including future uses and non-use values (such as cultural, symbolic, and aesthetic values) of an ecosystem.

Explanation:

Ecosystem may be defined as the constituent of the living and non living things present in the ecosystem. The living component includes the plants, animal and microorganisms. The non living component includes the water, air and soil.

The ecosystem provides oxygen and different gases important for sustain life. The ecosystem provides the aesthetic and cultural value that are used by future as well. Ecosystem provide medicine, food, furniture, fibers, habitat for the large number of organisms.

Thus, the correct answer is option (b).

Answer:

Tritiated thymine or tritiated thymidine

Explanation:

It would selectively label DNA but not RNA because of the presence of the uniformly labeled backbone phosphorus atoms in the DNA.

Answer:

The correct answer is option E, that is, 12.

Explanation:

It is mentioned that the markers are situated in six unlinked sites, the unlinked signifies that they are located on six distinct chromosomes. If one requires to augment the six markers, which are devoid of any definite end sequence, then only six forward primers are adequate. However, if one needs to augment a particular region on the chromosome, then both the reverse and forward primers are needed for each marker. Thus, a sum of 12 primers is required in such a case.  

In case, if all the markers are situated in a single chromosome inside a particular region, then only one forward or both reverse and forward primers, that is, two primers would suffice. Generally, the technique of PCR is used to intensify particular fragments and both end and start sequences are illustrated. In such a case, the markers are specified.  

Therefore, both reverse and forward primers are needed to augment every marker. Hence, it can be concluded that 12 primers are needed to augment all six markers situated on six unlinked sites.  

Answer:

The horse has 64 number of chromosomes and the donkey has 62 number of chromosomes.

At the time of recombination the number of chromosomes which will be formed will be odd in number.

32 from horse and 31 from donkey which combines to form 63 pair. This is a odd number so there can be no equal number of segregation of chromosomes.

This is the fact the offspring produced by crossing a donkey and horse is sterile.

The procedure and conditions under which photosynthesis is conducted can affect the outcome and changes in the outcome may indicate alterations in the net rate of photosynthesis. Several factors related to the procedure, such as light intensity, temperature, carbon dioxide concentration, water availability, chlorophyll content, and duration of the experiment, can impact the outcome. Researchers often conduct controlled experiments to understand the specific factors influencing photosynthesis.

The procedure and conditions under which photosynthesis is conducted can indeed affect the outcome, and changes in the outcome may indicate alterations in the net rate of photosynthesis. Photosynthesis is a complex process that involves several factors, and variations in the experimental setup can influence its efficiency.

Here are a few factors related to the procedure that can impact the outcome:

If the outcome changes, it may indicate a difference in the net rate of photosynthesis. An increase in the outcome might suggest an enhancement in photosynthetic activity, while a decrease could indicate a reduction. Researchers often conduct controlled experiments, adjusting one variable at a time while keeping others constant, to understand the specific factors influencing photosynthesis.

The parental genotypes for the snapdragons are homozygous red with normal shape and homozygous white with abnormal shape. F2 genotypes show incomplete dominance for color and Mendelian inheritance for shape. Incomplete dominance results in a 1:2:1 phenotypic ratio, while shape follows a dominant-recessive pattern.

The student is dealing with incomplete dominance in snapdragons, where red flower color (CRCR) and white flower color (CWCW) blend to produce pink flowers (CRCW). Given the F2 generation's phenotypic ratios, we can infer the parental genotypes that produced the F1 generation with pink, normally shaped flowers.

a) Parental genotypes: One parent must have been red, homozygous normal (CRCR) and the other white, homozygous abnormal (CWCW). This explains the F1 generation of all pink, normal shaped flowers (CRCW).

b) F2 genotypes and phenotypes: The F2 generation shows phenotypes and genotypes based on independent segregation and incomplete dominance of flower color and normality of shape. Using a Punnett square for dihybrid cross, we have a genotypic ratio for color and shape. For color: CRCR (red), CRCW (pink), CWCW (white), and for shape, normal (N) is dominant over abnormal (n). The F2 would be: 3/16 CRCR-NN (red, normal), 6/16 CRCW-NN or -Nn (pink, normal), 3/16 CWCW-NN or -Nn (white, normal), 2/16 CRCW-nn (pink, abnormal), 1/16 CRCR-nn (red, abnormal), 1/16 CWCW-nn (white, abnormal).

c) Conclusions about allelic and gene interactions: The flower color demonstrates incomplete dominance, as neither red nor white is completely dominant. The F1 and F2 ratios suggest that flower shape acts as a simple Mendelian trait, with normal being dominant to abnormal. Therefore, the interaction is that color exhibits incomplete dominance whereas shape follows typical Mendelian inheritance.

Answer:

single dominant epistatits

Explanation:

When a dominant allele at one locus can mask the expression of both alleles (dominant and recessive) at another locus, it is known as dominant epistasis. In other words, the expression of one dominant or recessive allele is masked by another dominant gene. This is also referred to as simple epistasis

Final answer:

Epistasis is the genetic phenomenon influencing the expression of one gene by another gene. In this case, the most likely mode of inheritance for the plumage phenotypes is duplicate recessive epistasis (c).

Explanation:

Epistasis is a genetic phenomenon in which the expression of one gene is influenced by another gene. In this case, since the plumage phenotypes dull, bright, and brilliant do not follow a simple dominant or recessive inheritance pattern, the most likely mode of inheritance would be duplicate recessive epistasis (c). This means that two recessive alleles at different loci are required to produce a specific phenotype.

Answer:

The correct answer is option c. "old layers of xylem and phloem".

Explanation:

Wood is one important good used for construction obtained from the main substance of the outer layer of the trunk or branches of a tree. Biologically, the outer layer of the trunk of a tree is comprised of the old layers of xylem and phloem, which are dead cells that were part of the heartwood or the centre of the tree. These old layers of xylem and phloem form the outer bark structure of the tree.

The Calvin cycle produces Glyceraldehyde-3-phosphate (G3P) that can be converted to other compounds such as carbohydrates, fatty acids, and amino acids. Algal and plant cells, compared to animal cells, have greater carbon fixation abilities due to their capacity to execute photosynthesis.

The Calvin cycle produces a versatile chemical compound called Glyceraldehyde-3-phosphate (G3P), which can be converted to many carbohydrates, as well as fatty acids and amino acids. The Calvin cycle harnesses energy in the form of ATP and NADPH to produce G3P. During this light-independent reaction of photosynthesis, carbon dioxide from the atmosphere is converted into carbohydrates using an enzyme called RuBisCO.

After three cycles, some G3P molecules leave the cycle to become part of a carbohydrate molecule, while the remaining G3P molecules stay in the cycle to be regenerated into RuBP, ready to react with more CO₂. Both algal and plant cells have enormous carbon fixation capabilities compared to animal cells due to their ability to perform photosynthesis, which forms an energy cycle with the process of cellular respiration. This allows plants to function in both light and dark conditions and to interconvert essential metabolites.

https://brainly.com/question/34149547

#SPJ3

C) A and B only  is the right option.

Explanation:

During the process of cell division as mitosis or meiosis, the random segregation of mitochondria takes place in the resulting daughter cells

It is found that when cell divides, mitochondria present on the opposite side of the cell plate will have daughter cells that are different from the progenitor cell with respect to  mitochondria. Due to this reason, it is difficult to predict the percentage of mitochondrial mutation passed on.

Also, it is proved that only maternal cells are capable of passing the mitochondrial DNA.

Final answer:

Mutated mitochondria are distributed randomly during cell division, leading to varying percentages in daughter cells.

Explanation:

When a mutation arises on the mitochondrial genome and 10% of the mitochondria in a cell have that mutation during cytokinesis, the distribution of the mutated mitochondria will be random in the daughter cells. Since mitochondria divide independently and are distributed randomly during cell division, there is no precise mechanism to ensure equal distribution of mutated mitochondria. Therefore, the percentage of mitochondria with the mutation in the two daughter cells will vary and could differ from the initial 10%.

Answer:

1) Since all the important tissues like the sensory and nervous tissues have been concentrated on the head, a damage to the head will lead to a damage to important organs.

2) The animal would not be able to see activities taking place behind the head.

Final answer:

To calculate the average metabolic rate of a 65-kg person with specified activities, one must understand the metabolic rate, including the basal metabolic rate and the additional energy expended during physical activities.

Explanation:

The question involves calculating the average metabolic rate of a 65-kg person based on their daily activities, including sleeping, sitting at a desk, engaging in light activity, watching TV, playing tennis, and running. This calculation requires understanding the concept of the metabolic rate, which describes the rate at which the body uses energy for basic functions at rest (known as basal metabolic rate, or BMR) and activities. The BMR varies with age, gender, body weight, and muscle mass. Athletes, for example, have a higher BMR. Additionally, the energy expended in physical activities contributes to the total daily energy expenditure, which can be significantly higher than the BMR alone. The daily energy needs thus depend on both the BMR and the energy spent on various activities throughout the day.

Answer:

The frequency of bb individuals between successive generations wasn't always the same because of natural selection. The capacity of reproduction decreased by a small portion.

Explanation:

Natural selection is the reason why the reproduction of bb generations wasn't always the same. The randomly selection of mates to reproduce was also variable.

Final answer:

The decrease in the frequency of bb individuals between successive generations is not consistent due to genetic drift, natural selection, and population size variations. Factors such as the survival advantage/disadvantage of the bb genotype and the population size significantly influence these changes, making the Hardy-Weinberg Equilibrium principle's assumption of constant allele frequency not always applicable.

Explanation:

The decrease in the frequency of bb individuals between successive generations is not always the same due to factors such as genetic drift, natural selection, and population size. Genetic drift, particularly in small populations, can lead to significant fluctuations in allele frequencies over time. Natural selection can either increase or decrease the frequency of bb individuals depending on whether the bb genotype confers a survival advantage or disadvantage. Additionally, the size of the population plays a crucial role; smaller populations are more susceptible to changes in allele frequency due to random events.

Therefore, the Hardy-Weinberg Equilibrium principle's assumption about constant allele frequency does not always hold in natural populations. The frequency of the bb genotype can vary across generations due to selection, genetic drift, and changes in population size. Each generation's genetic makeup is determined by the alleles passed down from the parents, with the frequency of bb potentially rising or falling based on these evolutionary forces.

Answer: Population

All the newts in the pond best describes population

Explanation:

Population is the total number of organisms of the same species living together in a given area at a particular time. In an ecosystem, the community is made up of many populations of different species of organisms relating with their environment.

Therefore, of all the different species of organisms present in the pond, the newts alone best describes a population

Answer: Option C.

It describes population.

Explanation:

Population is the sum total of living organisms of the same species that live in a particular geographical area, interacting with each other and are capable of interbreeding. The newts in the pond is described as population. Because there are many number of newts that are living and interbreeding in the ponds.

Answer: Option A) parasympathetic nervous system

Explanation:

The autonomic nervous system consists of two parts namely

- the sympathetic nervous system SNS, and

- the parasympathetic nervous system PNS

The PNS stimulates the same organs as SNS, but its action is opposite to SNS.

And it acts to return the body to a normal state, thus it is associated with actions such as:

- slowing heart beat

- dilates arteries,

- lowering blood pressure

- stimulating saliva secretion etc

All these actions of the PNS bring about rest, repair, and energy storage.

Answer: During photosynthesis, green plants uses light energy from sunlight to convert carbon dioxide and water to glucose and water. Light energy is converted to chemical energy during photosynthesis.

Explanation:

Photosynthesis is the process by which green plants uses light energy from sunlight to produce carbohydrates by converting carbon dioxide and water to carbohydrates and oxygen.

Final answer:

Phytoplankton are the most important primary producers in the marine aquatic food web, performing most of the ocean's photosynthesis and supporting the food web as the main food source for zooplankton, the primary consumers.

Explanation:

The most important primary producers in the marine aquatic food web are phytoplankton. Phytoplankton can be found floating on or near the surface of the water where sunlight can penetrate, and they perform the bulk of the ocean's photosynthesis, contributing to 95% of the ocean's primary productivity. These organisms can typically be found up to the depth where light can still reach, which is known as the euphotic or photic zone.

This zone can extend to depths of about 200 meters but varies depending on water clarity. Phytoplankton serve as the foundation of the marine food web, feeding zooplankton which represent the primary consumer level, followed by secondary consumers such as small fish.

Phytoplankton play a crucial role in both aquatic and terrestrial environments as they are significant consumers of carbon dioxide (CO2) and producers of oxygen through the process of photosynthesis. Their abundance and health are thus critical for marine ecosystems and global carbon cycles.

Answer:

. 2) DNA utilizes tRNA to control the amino acid sequence of proteins.

3) mRNA catalyzes the formation of peptide bonds, linking amino acids together to form proteins.

Explanation:

The formation of peptide bonds of polypeptide chains to form protein is by enzyme peptidyl   transferase. This enzyme is located in the large   ribosome sub-units;(ribosomes is made up of large and small sub units),and it made up of  RNA.

Thus option 3 that mRNA catalyze the peptide bond for linking amino acids together is correct. The process of mRNA catalysis  takes place in the cytoplasm.it begins with the alignment of the mRNA bases(condons) on the ribosomes sub-units, and corresponding alignment of the tRNA, in such a way that  the anticodon at its head bonded  by hydrogen bonds with the codon on the mRNA. The  codon-anticodon bonding continues  based on the type of protein attached to the  head of the   tRNA and  and the  corresponding condon and anticodon  bonding .

The amino acids are joined together by  peptide bonds. This extends with each additional amino acids to form polypeptide chains of amino acids The  reactions is  catalyzed by the (RNA contained   peptidyl transferase  above).

The main objective of DNA in gene expression  is to produce required proteins needed for cellular reactions. Therefore for correct delivery of the  DNA coded messages transcribed  in the mRNA it must utilize tRNA so that correct protein sequence  are positioned by tRNA as anti codons to bond with codons on the mRNA.  This regulation is control at the transcription level coordinated by the DNA, under the influence of an enzyme.Therefore the option 2 that DNA utilizes tRNA to control the amino acid sequence of proteins is correct.

NOTE

Option 1,is wrong because transcription is the process of transfering coded information from DNA to mRNA, not as quoted in the question

Option 4. is wrong because the process of producing new DNA replica from original DNA molecule is called Replication, not as quoted,

Answer: The following statements are true:

2) DNA utilizes tRNA to control the amino acid sequence of proteins.

3) mRNA catalyzes the formation of peptide bonds, linking amino acids together to form proteins.

Explanation: mRna carries the information from DNA in the form of codon, each three nucleotide form a codon for one specific amino acids. When mRna binds to ribosomal subunit, translation (protein synthesis) starts.

tRNA carries the anticodon that are complemented to mRna codons and they carry these anticodons to ribosome where translation process occurs, thus, tRNA will help in the protein synthesis by binding that specific amino acid to growing polypeptide.

Answer:

A) Propose two ways in which antibiotic resistance may develop in a bacterium?

Antibiotic resistance may develop in a bacterium through A GENETIC MUTATION and BY REQUIRING RESISTANCE FROM ANOTHER BACTERIUM

B.) Describe how bacterial cells acquire the ability to produce toxins?

The virulent strains of bacteria as in Corynebacterium diphtheria, and Streptococcus pyogenes all manufacture toxins with weighty physiological impacts, unlike the nonvirulent strains which do not manufacture toxins. The toxins are generated by a bacteriophage gene that has been received by transduction.

Using the knowledge of DNA recombination events to complete the -

1. Antibiotic resistance means some bacteria can grow and survive in the presence of one or more antibiotics like tetracycline, ampicillin, or others.  It can be developed by 1) horizontal gene transfer 2) Mutation

2. Pathogenic bacteria may produce toxins. Toxins are of two types; exotoxins & endotoxins.

Thus, the explanation is given above about the way resistance develops and the production of toxins.

Learn more:

https://brainly.com/question/12940685

Answer:

The correct answer is "A single-celled zygote develops into an organism with trillions of cells by going trough multiple mitotic processes; a mitotic cell will undergo 47 mitotic divisions to develop into an organism with 100 trillion cells".

Explanation:

It is fascinating how a single-celled zygote develops into an organism with trillions of cells. The key of an organism's development is called mitosis: a cell division process at which a parent cells produces two daughter cells. Apparently producing two cells from one is not much, but it should be taken into account that it is an exponential process. For instance, a mitotic cell will undergo 47 mitotic divisions to develop into an organism with 100 trillion cells (2^47=140 trillion).

We developed  from a single-celled zygote to an organism with trillions of

cells through series of cell divisions known as Mitosis.

It will take about 47 mitotic cell divisions for one zygote to grow into an

organism with 100 trillion cells.

Mitosis is a type of cell division that is associated with growth and

replacement of tissues. It helps in the division of cells to enable them

become more specialized in functions and structure.

It will take about 47 mitotic cell divisions for one zygote to grow into an

organism with 100 trillion cells as the cells divides at a higher degree.

Read more on https://brainly.com/question/14656628