List the sources of experimental uncertainty. List steps you will take to minimize the uncertainties.

Answers

Answer 1

Answer:

Sources of experimental uncertainties

1. Environment- change in environment can bring about experimental error e.g change Temperature can affect crop yield.

2. Wrong caibration of equipment- some equipment need to be calibrated before use. Wrong calibration brings error

Explanation: steps to uncertainties

1.Calibrate equipment when necessary.

2. Ensure fomulars are rightly imputed for electronic devices

3. Experience and competency is needed to avoid Esperanza uncertainties. Expert can be employed

4. Replication for field work reduces uncertainties. E.g maize of the same varieties can be planted in three places on the field to avoid uncertainties.


Related Questions

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion

Answers

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

The Earth is about 4.6 billion years old. However, the oldest sea floor is only about 180 million years old. What do you think is the reason for this? (Hint: Remember that new seafloor is constantly being created, but the Earth is not getting bigger with time.)

Answers

Answer:

The seafloor is only 180 million years old due to the process of subduction. The floor of the sea's tends to get colder and denser with the passage of time. At a certain time, the seafloor becomes so dense that it sinks in the upper mantle. The Earth's crust cannot undergo this process and hence has oldest rocks. We can say that the seafloor is less than 180 million years old because it is typically recycled back into the mantle of the Earth.

Final answer:

The oldest sea floor is only 180 million years old because new seafloor is constantly being created through seafloor spreading at mid-ocean ridges.

Explanation:

The reason that the oldest sea floor is only about 180 million years old, while the Earth is 4.6 billion years old, is because new seafloor is constantly being created through a process called seafloor spreading. This process occurs at mid-ocean ridges, where tectonic plates are moving apart.

As the plates separate, magma from the Earth's mantle rises and solidifies, forming new oceanic crust. Over time, this new crust moves away from the ridge and gets older, while new crust forms at the ridge. Therefore, the oldest sea floor is relatively young compared to the age of the Earth.

Learn more about seafloor spreading here:

https://brainly.com/question/15122129

#SPJ3

25. Select all accurate statements
A. All chordates will have a notochord as adults
B. All chordates have a ventral, hollow nerve cord
C. All chordates have pharyngeal slits or clefts
D. All chordates are bilaterally symmetrical animals.
E. All chordates will have a muscular post an*l tail

Answers

Answer:

A, B, and D

Explanation:

The observed numbers for dominant and recessive types in an F2 generation are 154 and 46. What would the expected number of individuals with a heterozygous genotype?

Answers

Answer: Expected heterozygous genotype = 2×46 = 92

Explanation:

According to the hypothesis of segregation of paired genes in heterozygous F1 generation crosses produces 1:2:1 genotype ratio. This means that all these three possible genotypes should be produced in the F2 generation meaning that we have 1(Dominant homozygous) :2 (Dominant heterozygous): 1 (Recessive Homozygous).

Phenotypic ratio shared (dominant: recessive) = 154 and 46

If recessive homozygous phenotype = recessive homozygous genotype = 46

The expected dominant heterozygous genotype= 2 × (recessive homozygous genotype)

= 2 × 46 = 92

A horse has 64 chromosomes and a donkey has 62 chromosomes. A cross between a female horse and a male donkey produces a mule, which is usually sterile. How many chromosomes does a mule have? Can you think of any reasons for the fact that most mules are sterile?

Answers

Answer:

The horse has 64 number of chromosomes and the donkey has 62 number of chromosomes.

At the time of recombination the number of chromosomes which will be formed will be odd in number.

32 from horse and 31 from donkey which combines to form 63 pair. This is a odd number so there can be no equal number of segregation of chromosomes.

This is the fact the offspring produced by crossing a donkey and horse is sterile.

The cell responsible for secreting the matrix of bone is the__________a. osteoclast. b. chondroblast. c. chondrocyte. d. osteoblast.

Answers

Answer

D.Osteoblasts

Explanation:

Appositional growth is the increase in the diameter of bones by the addition of bony tissue at the surface of bones. Osteoblasts at the bone surface secrete bone matrix, and osteoclasts on the inner surface break down bone. The osteoblasts differentiate into osteocytes.

Final answer:

The cell responsible for secreting the matrix of bone is the osteoblast, which supports the growth, maintenance, and repair of bones.

Explanation:

The cell responsible for secreting the matrix of bone is the osteoblast. Osteoblasts are a type of bone cell that form new bone, or 'osteo', tissue. They do this by secreting a matrix that later mineralizes to become hardened bone tissue. This process is critical for the growth, maintenance, and repair of bones in the body.

In contrast, osteoclasts are involved primarily in the breakdown and resorption of bone tissue, while chondroblasts and chondrocytes are associated with cartilage formation and maintenance, not with bone tissue formation.

Learn more about Osteoblast here:

https://brainly.com/question/34181515

#SPJ6

An index fossil is:________.a. a fossil found in a particular site. b. the ideal specimen of that species to which all later descriptions must refer. c. the type specimen of a species. d. a fossil used to categorize a stratigraphic layer.

Answers

Answer:

Option d, a fossil used to categorize a stratigraphic layer

Explanation:

Fossils that are typical of a specific time range in the course of history of evolution of earth are generally termed as index fossil.  These fossils can be used to determine the age of the rock layers and fossils with in which they are found. An index fossil must have a unique identity so that it can be easily recognized.Along with this they must have a lived for a short span of time in horizontal rock layer which must be geographically widespread for matching up to huge distances.  

Hence, option D is correct

Answer:

Option (D)

Explanation:

An index fossil is usually defined as those fossil that appeared for a short geological time and were widely distributed over the surface of the earth. These fossils are extremely rare, and it plays an important role in determining the age of a rock, and it also helps in the correlation of rocks. A noticeable number of index fossil species were observed in different places on earth which were deposited on the rock sequences in the geological time.

It enables a geologist to categorize the different stratigraphic layers.

Thus, the correct answer is option (D).

Choose the best answer.
Her repeated pulmonary infections have weakened the right side of her heart, so it is enlarged.
a) Since blood is moving between her atria, the blood in her ventricles and arteries is staying where it is, distending those structures.
b) Since she has a pulmonary infection, more blood is being diverted to her lungs; this distends her pulmonary trunk and leaves less blood in the systemic circuit.
c) Since blood is moving from her systemic circuit into her pulmonary circuit, the pulmonary circuit is distended and the systemic circuit is low on blood.

Answers

Answer:

Option B

Explanation:

Failing of right side is usually caused by failure of left side of heart. Malfunctioned right side of the heart loses its power of efficient pumping and as a result of this the blood is pumped back into the lungs. This backward flow backs up in the veins thereby causing the fluid to swell and hence the swelling in various body parts such as legs, liver, GI tracts, abdomen etc.

Hence, option B is correct

Answer: Option B.

Explanation:

Pulmonary infection is also lung infection. It can be caused by virus, bacteria or fungi.

A person can be infected when he breathing the pathogens from the air. A person with pulmonary infection can have right sided heart failure.

Right sided heart failure occur when because of left sided heart failure. The left sided failure occur when the left ventricle loses power to pump blood to the rest of the body. As a result, blood is pump to the lungs which weaken the right side of the heart and this lead to right side heart failure.

If you want to use PCR technique to amplify markers located on six unlinked locations on the chromosomes, how many total unique primer sequences do you need? A. 1 B. 3 C. 6 D.8 E. 12

Answers

Answer:

The correct answer is option E, that is, 12.

Explanation:

It is mentioned that the markers are situated in six unlinked sites, the unlinked signifies that they are located on six distinct chromosomes. If one requires to augment the six markers, which are devoid of any definite end sequence, then only six forward primers are adequate. However, if one needs to augment a particular region on the chromosome, then both the reverse and forward primers are needed for each marker. Thus, a sum of 12 primers is required in such a case.  

In case, if all the markers are situated in a single chromosome inside a particular region, then only one forward or both reverse and forward primers, that is, two primers would suffice. Generally, the technique of PCR is used to intensify particular fragments and both end and start sequences are illustrated. In such a case, the markers are specified.  

Therefore, both reverse and forward primers are needed to augment every marker. Hence, it can be concluded that 12 primers are needed to augment all six markers situated on six unlinked sites.  

SMC (structural maintenance of chromosomes) proteins are associated with chromatin in many types of organisms. Two of the major complexes that eukaryotes possess are cohesins and condensins.
Sort the following phrases as describing cohesins, condensins, or both. Note: If you answer any part of this question incorrectly, a single red X will appear indicating that one or more of the phrases are sorted incorrectly.

1) generally dimeric, forming a V-shaped complex
2) hold sister chromatids together after replication, until chromatid separation
3) each terminus contains part of a site for ATP hydrolysis
4) contain two coiled-coil motifs connected by a hinge domain
5) associated with kleisin
6) essential for DNA replication and cell division
7) contributes to the compaction of chromosomes during mitosis and enables proper chromatid separation during anaphase

Answers

These have been sorted here:

Condensins - generally dimeric, forming a V-shaped complex.Cohesins - hold sister chromatids together after replication, until chromatid separation.Both - each terminus contains part of a site for ATP hydrolysis.Condensins - contain two coiled-coil motifs connected by a hing domain.Both - associated with kleisin.Both - essential for DNA replication and cell division.Condensins - contributes to the compaction of chromosomes during mitosis and enables proper chromatid separation during anaphase.

What are these

The SMC (structural maintenance of chromosomes) proteins encompass two major complexes in eukaryotes: cohesins and condensins.

Cohesins maintain sister chromatid cohesion after replication until separation, associated with kleisin, and crucial for DNA replication and cell division.

Read more on DNA replication https://brainly.com/question/21265857

#SPJ3

Final answer:

Cohesins and condensins are SMC protein complexes essential for chromosome maintenance in cell division. Cohesins primarily hold sister chromatids together, while condensins contribute to chromosome compaction during mitosis. Both share structural features and are crucial for DNA replication and cell division.

Explanation:

The SMC (structural maintenance of chromosomes) proteins are crucial for the proper regulation of chromosome structure and segregation during cell division. Specifically, in eukaryotes, cohesins and condensins are two major complexes involved in chromosome maintenance. The function and structure of these complexes can be described by the following phrases:

generally dimeric, forming a V-shaped complex - Both cohesins and condensinshold sister chromatids together after replication, until chromatid separation - Cohesinseach terminus contains part of a site for ATP hydrolysis - Both cohesins and condensinscontain two coiled-coil motifs connected by a hi-nge domain - Both cohesins and condensinsassociated with Klein - Both cohesins and condensinsessential for DNA replication and cell division - Both cohesins and condensinscontributes to the compaction of chromosomes during mitosis and enables proper chromatid separation during anaphase - Condensins

Suppose you want to radioactively label DNA but not RNA in dividing and growing bacterial cells. What radiolabeled molecule would you add to the culture medium? Why would it selectively label DNA but not RNA?

Answers

Answer:

Tritiated thymine or tritiated thymidine

Explanation:

It would selectively label DNA but not RNA because of the presence of the uniformly labeled backbone phosphorus atoms in the DNA.

What group of organisms are the most important primary producers in the marine aquatic food web? How deep down in the water column can they be found?

Answers

Final answer:

Phytoplankton are the most important primary producers in the marine aquatic food web, performing most of the ocean's photosynthesis and supporting the food web as the main food source for zooplankton, the primary consumers.

Explanation:

The most important primary producers in the marine aquatic food web are phytoplankton. Phytoplankton can be found floating on or near the surface of the water where sunlight can penetrate, and they perform the bulk of the ocean's photosynthesis, contributing to 95% of the ocean's primary productivity. These organisms can typically be found up to the depth where light can still reach, which is known as the euphotic or photic zone.

This zone can extend to depths of about 200 meters but varies depending on water clarity. Phytoplankton serve as the foundation of the marine food web, feeding zooplankton which represent the primary consumer level, followed by secondary consumers such as small fish.

Phytoplankton play a crucial role in both aquatic and terrestrial environments as they are significant consumers of carbon dioxide (CO2) and producers of oxygen through the process of photosynthesis. Their abundance and health are thus critical for marine ecosystems and global carbon cycles.


A single newt is part of all the newts in a pond. The pond contains many more organisms as well as abiotic factors. The pond is part of a bigger picture, an ecosystem.

Which term BEST describes all the newts in a pond?

A) community
B) individual
C) population
D) species

Answers

Answer: Population

All the newts in the pond best describes population

Explanation:

Population is the total number of organisms of the same species living together in a given area at a particular time. In an ecosystem, the community is made up of many populations of different species of organisms relating with their environment.

Therefore, of all the different species of organisms present in the pond, the newts alone best describes a population

Answer: Option C.

It describes population.

Explanation:

Population is the sum total of living organisms of the same species that live in a particular geographical area, interacting with each other and are capable of interbreeding. The newts in the pond is described as population. Because there are many number of newts that are living and interbreeding in the ponds.

Food couldn't reach the stomach without the blank and the blank

Answers

Answer:

Food could not reach the stomach without the "esophagus and the throat".

Explanation:

Esophagus is like an elastic pipe, about 25 cm in length. It passes food from the throat back towards the stomach. There's the trachea at the back of the mouth which enables air to come in and out of the body. Once food in the form of a small ball of mushed-up food or liquids is ingested, the epiglottis slips down the opening of the windpipe to ensure that the food reaches the esophagus and not the windpipe.

Final answer:

Food is transported to the stomach via the esophagus with the help of the pharynx through peristalsis. Once in the stomach, food is stored, chemically digested, and mechanically broken down into chyme before moving into the small intestine.

Explanation:

Food couldn't reach the stomach without the involvement of the esophagus and the pharynx. The esophagus is a muscular tube that connects the pharynx to the stomach, and its main function is to transport food from the throat down into the stomach. The pharynx, also part of the digestive tract, is the area at the back of the throat that receives food from the mouth. Together, the coordinated contractions of these structures move food along in a process called peristalsis. After passing through the esophagus, the food reaches the stomach, where it is stored and chemical digestion begins in earnest, starting with the conversion of food into a semi-liquid mixture called chyme. The stomach's muscular movements help in further breaking down the food before it enters the small intestine for continued digestion and absorption.

Interneurons don't conduct signals from one structure to another; a. they integrate activity within a single brain structure. b. have two short axons but no dendrites. c. have one long axon and one short dendrite. d. have several short axons and no dendrites. e. have bipolar axons and no dendrites.

Answers

Answer:

a. they integrate activity within a single brain structure.

Explanation:

This can be local interneurons and relay interneuron based on function and structure.

Based on  function the interneuron synapse with the  sensory and motor neurons,This structural characteristic is related to their functions. Thus as sensory neurons synapse with the Interneurones,  the recieved message from sensory neuron of the spinal cord  first branched off to the brain for processing and analysis, and  output (response) from the brain returns to the interneuron , which synapse this with the motor neurons, for transmission to the effectors.

This  type of information integration  and processing is especially important when processing information from high brain centers, and  complex tasks,and it involved the relay interneuron. This explains  the integration function  within the brain structure.

However if the information is simple the local interneuron mediated this/ a sensory information is not sent to the brain. Rather the information is transmitted from the sensory to the motor , coordinated by the spinal cord and response is transmitted to the effectors.

Victoria needs to work through the night to finish a project for class. Victoria is concerned she will be too sleepy so she drinks energy drinks throughout the night to keep her alert and awake.What are the affects of energy drink?

Answers

Answer:

Victoria will intially felt active, reduced sleepiness but consuming too much caffeine may be risky.

Explanation:

Victoria will felt more active and alert after 30-45 minutes of drinking the enrergy drink because energy drink contains caffeine and its concentration in at peak after 30-45 minutes. Caffeine will reduce sleepiness.

Caffeine will block the adenosine pathway for short period of time. Adenosine is a chemical becuase of which we felt tired and Caffeine will allow feel good molecules to be released in brain such as dopamine. That why Victoria will felt more active, concentrated and good.

But consuming too much energy drinks mean victoria will be consuming too much caffeine that may be risky.Excess amount of caffeine can cause vomiting, nausea, convulsions and high blood pressure even can cause death.

A scientist discovers a DNA-based test for one allele of a particular gene. This and only this allele, if homozygous, produces an effect that results in death at or about the time of birth. Which of the following statements describes the best use of this discovery?
a. Screen all newborns of an at-risk population.
b. Design a test for identifying heterozygous carriers of the allele.
c. Follow the segregation of the allele during meiosis.
d. Introduce a normal allele into deficient newborns.

Answers

Answer:

b. Design a test for identifying heterozygous carriers of the allele.

Answer:

A scientist discovers a DNA-based test for one allele of a particular gene. This and only this allele, if homozygous, produces an effect that results in death at or about the time of birth. Which of the following statements describes the best use of this discovery?

Screen all newborns of an at-risk population.

Explanation:

When all newborns are screened, it enable the researcher to identify areas with lapses   in order to correct such either by introducing an heterozygous to correct the abnormality

The mitochondria within eukaryotic cells have their own genomes. Imagine that a mutation arises on the mitochondrial genome and, at the time of cytokinesis of the host cell, 10% of the mitochondria in that cell have that mutation. In the two daughter cells, what percentage of the mitochondria will possess that mutation? A. Although the cytoplasm containing the mitochondria will be equally divided between the two cells, there is no precise mechanism for ensuring that the organelles are equally divided.B. One cannot accurately predict what the percentages will be in each cell.C. 50% eachD. A and B onlyE. None of the above

Answers

C) A and B only  is the right option.

Explanation:

During the process of cell division as mitosis or meiosis, the random segregation of mitochondria takes place in the resulting daughter cells

It is found that when cell divides, mitochondria present on the opposite side of the cell plate will have daughter cells that are different from the progenitor cell with respect to  mitochondria. Due to this reason, it is difficult to predict the percentage of mitochondrial mutation passed on.

Also, it is proved that only maternal cells are capable of passing the mitochondrial DNA.

Final answer:

Mutated mitochondria are distributed randomly during cell division, leading to varying percentages in daughter cells.

Explanation:

When a mutation arises on the mitochondrial genome and 10% of the mitochondria in a cell have that mutation during cytokinesis, the distribution of the mutated mitochondria will be random in the daughter cells. Since mitochondria divide independently and are distributed randomly during cell division, there is no precise mechanism to ensure equal distribution of mutated mitochondria. Therefore, the percentage of mitochondria with the mutation in the two daughter cells will vary and could differ from the initial 10%.

Could the way you perform the procedure affect the outcome? If the outcome changes, does it mean the net rate of photosynthesis has changed?

Answers

The procedure and conditions under which photosynthesis is conducted can affect the outcome and changes in the outcome may indicate alterations in the net rate of photosynthesis. Several factors related to the procedure, such as light intensity, temperature, carbon dioxide concentration, water availability, chlorophyll content, and duration of the experiment, can impact the outcome. Researchers often conduct controlled experiments to understand the specific factors influencing photosynthesis.

The procedure and conditions under which photosynthesis is conducted can indeed affect the outcome, and changes in the outcome may indicate alterations in the net rate of photosynthesis. Photosynthesis is a complex process that involves several factors, and variations in the experimental setup can influence its efficiency.

Here are a few factors related to the procedure that can impact the outcome:

Light Intensity: The rate of photosynthesis is often directly proportional to the intensity of light. If the light source or its intensity changes, it can affect the rate of photosynthesis.Temperature: Photosynthesis is also temperature-sensitive. A change in the temperature of the environment can influence the activity of enzymes involved in photosynthesis and, consequently, the overall rate of the process.Carbon Dioxide Concentration: Alterations in the concentration of carbon dioxide (CO2) can impact photosynthesis. If the experimental conditions lead to changes in CO2 availability, it can affect the outcome.Water Availability: Water is a crucial component of photosynthesis. If there are variations in water availability or if the plant experiences water stress, it can affect the rate of photosynthesis.Chlorophyll Content: The health and amount of chlorophyll in plant cells play a vital role in photosynthesis. Any changes in the procedure that affect chlorophyll content can influence the outcome.Duration of the Experiment: The duration for which the experiment is conducted can also impact the results. Photosynthesis rates might change over time due to various factors.

If the outcome changes, it may indicate a difference in the net rate of photosynthesis. An increase in the outcome might suggest an enhancement in photosynthetic activity, while a decrease could indicate a reduction. Researchers often conduct controlled experiments, adjusting one variable at a time while keeping others constant, to understand the specific factors influencing photosynthesis.

Classifying Life on Earth - Kingdoms
Listed in the Item Bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into the correct column. Order does not matter.
ITEM BANK: Move to Bottom
AnimaliaArchaebacteriaEubacteriaFungiPlantaeProtista
Prokaryotic Unicellular
Eukaryotic Multicellular Autotroph
Eukaryotic Multicellular Heterotroph
Eukaryotic Unicellular/Multicellular Auto/Heterotroph

Answers

Animalia: Eukaryotic multicellular heterotroph

Arachaebacteria: Prokaryotic unicellular

Eubacteria: Prokaryotic unicellular  

Fungi: Eukaryotic multicellular heterotroph

Plantae: Eukaryotic multicellular autotroph

Protista: Eukaryotic unicellular/multicellular auto/heterotroph

Explanation:

Living organisms of different kingdoms are classified according to their number of cells, type of nutrition and presence or absence of nucleus.

Unicellular: single celled organism; multicellular: organisms with multiple number of cells

Prokaryotic: absence of nucleus or membrane-bound cellular organelles. Eukaryotic: nucleus is present

Autotroph: Prepares their own food. Heterotroph: Depends on other organisms for food

Species belonging to Kingdom Animalia are eukaryotic, multicellular, heterotrophic, motile, reproduce sexually or asexually.

Species belonging to Kingdom Plantae are eukaryotic, multicellular, autotrophic, nonmotile, reproduce sexually or asexually.

Species belonging to Kingdom Protista are eukaryotic, unicellular or multicellular, and can be autotrophic or heterotrophic, reproduce sexually or asexually.

Species belonging to Kingdom Fungi are eukaryotic, multicellular (few are unicellular), heterotrophs – saprophytes or parasites

Species belonging to Kingdom Monera including arachaebacteria and eubacteria are prokaryotic unicellular organisms, reproduce asexually

The classification of living organisms is arranged in the order and they are listed below Archaebacteria, Eubacteria, Fungi, Protista, Plants, Animals.

Explanation:

1. Animals - Eukaryotic Multicellular Heterotroph

Cell type- EukaryoticMode of nutrition- HeterotrophNumber of cells- Multicellular

2. Plants - Eukaryotic Multicellular Autotroph

Cell type- EukaryoticMode of nutrition- AutotrophNumber of cells- Multi-cellular

3. Fungi - Eukaryotic Unicellular/Multicellular Auto/Heterotroph

Cell type- EukaryoticMode of nutrition- HeterotrophNumber of cells- Multi-cellular /unicellular

4. Protista - Eukaryotic Unicellular/Multicellular Auto/Heterotroph

Cell type- EukaryoticMode of nutrition- Heterotroph/AutotrophNumber of cells- Multi-cellular /uni-cellular

5. Bacteria - Prokaryotic Unicellular

Cell type- ProkaryoticMode of nutrition- Heterotroph/AutotrophNumber of cells-Uni-cellular

6. Archae - bacteria-Prokaryotic Unicellular

Cell type - ProkaryoticMode of nutrition - Heterotroph/AutotrophNumber of cells - Uni-cellular

Which of the following statements concerning transcription is true?
A. All types of RNA in the cell are synthesized by transcription, which uses a portion of DNA as a template for copying.
B. Promoter sequences signal the end of a gene and mark the place where transcription stops.
C. During transcription, entire chromosomes are copied because the starting position of genes is unknown.
D. Transcription is the process whereby identical copies of DNA are made in preparation for cell division.

Answers

Answer: Option A) All types of RNA in the cell are synthesized by transcription, which uses a portion of DNA as a template for copying.

Explanation:

All types of RNA:

- viral RNA,

- ribosomal RNA,

- transfer RNA,

- messenger RNA and

- double-stranded RNA, have a sequence that is the same as 'antisense' strand of the DNA.

Thus, it is true that all types of RNA in the cell are synthesized by transcription, which uses a portion of DNA as a template for copying.

Final answer:

Option A is the correct statement regarding transcription: All types of RNA in the cell are synthesized by transcription using a portion of DNA as a template.

Explanation:

The correct statement concerning transcription is option A: All types of RNA in the cell are synthesized by transcription, which uses a portion of DNA as a template for copying. Transcription is the process by which an RNA molecule is synthesized using a DNA template. Specific sequences called promoters signal the start of a gene, and terminator sequences signal the end of gene transcription, not the other way around as mentioned in option B. The entire chromosome is not copied during transcription; only the specific gene being transcribed is copied.

Learn more about transcription here:

https://brainly.com/question/32921071

#SPJ6

Which of the following is the best explanation for why cells are considered the smallest units of living things. Cells have the ability to reproduce identical copies of themselves in a process called mitosis. Cells cannot be seen with the naked eye and are considered microscopic. Cells are the simplest structure to fit all of the characteristics necessary to be considered alive. Cells are highly ordered and complex.

Answers

Answer: Cells are the simplest structure to fit all of the characteristics necessary to be considered alive.

Explanation:

The cell is regarded as the smallest unit of all living things because it can carry out all life activities such as:

- feeding

- reproduction

- excretion

- growth

- adaptation

- respiration

- definite life span

- sensitivity, and

- movement

All these characteristics possessed by cells are the characteristics of living things.

Answer: Cells are the simplest structure to fit all the characteristics to necessary to be considered alive.

Explanation:

Cell is the smallest and basic units of life I.e it is the building blocks of living organisms. Cells can exist on their own. Cells are the smallest unit of life because they are the smallest components of living organisms and have simplest structure to fit characteristics to be considered alive.

These characteristics are exhibited by living cells and they are;

Reproduction, feeding,respiration, movement, sensitivity, excretion ,growth and death.

Gibson Assembly – Several enzymes are present in the Gibson assembly reaction. For each of the following enzymes, define the role of the enzyme at room temperature (when the reaction is set up) and at 50 °C (the temperature for the 30 minute incubation after set up).

a. Phusion DNA polymerase ,
b. T5 exonuclease ,
c. Taq DNA ligase

Answers

Answer with explanation:

Gibson Assembly is a method of molecular cloning which join multiple DNA fragments in a single reaction.  It was created by Daniel G. Gibson, Chief Technology Officer and co-founder of SGI-DNA. (See attached picture)

a. Role of Phusion DNA Polymerase

It bring the enzymes closer to DNA fragment and help enzymes to make PCR product with speed and more accurately. Moreover it has the ability of amplifying long templates. (See attached picture)

a. Role of T5 exonuclease

It is an exonuclease enzyme which means it remove the nucleotide from DNA stand in 5´ to 3´ direction. It create nicks in the double stranded DNA for the incorporation of other fragments. Furthermore, it also work fine in single stranded DNA. (See attached picture)

a. Role of Taq DNA ligase

It is a thermostable enzyme which catalyzes the phosphodiester bond formation between 5´-phosphate and the 3´-hydroxyl of two adjacent DNA strands. (See attached picture)

We are interested in determining whether plumage for the Guinea hens follow a common epistatic relationship. The observed phenotypes are dull, bright and brilliant. Which mode of inheritance would most likely explain the data below? Phenotype Dull 136 Bright 94 Brilliant 13 Total 243Select One:a. dominant/recessive epistasis b. duplicate dominant epistasis c. duplicate recessive epistasis d. duplicate genes with cumulative effect e. single recessive epistasis f. single dominant epistasis

Answers

Answer:

single dominant epistatits

Explanation:

When a dominant allele at one locus can mask the expression of both alleles (dominant and recessive) at another locus, it is known as dominant epistasis. In other words, the expression of one dominant or recessive allele is masked by another dominant gene. This is also referred to as simple epistasis

Final answer:

Epistasis is the genetic phenomenon influencing the expression of one gene by another gene. In this case, the most likely mode of inheritance for the plumage phenotypes is duplicate recessive epistasis (c).

Explanation:

Epistasis is a genetic phenomenon in which the expression of one gene is influenced by another gene. In this case, since the plumage phenotypes dull, bright, and brilliant do not follow a simple dominant or recessive inheritance pattern, the most likely mode of inheritance would be duplicate recessive epistasis (c). This means that two recessive alleles at different loci are required to produce a specific phenotype.

Using your knowledge of DNA recombination events to complete the following: Propose two ways in which antibiotic resistance may develop in a bacterium Describe how bacterial cells acquire the ability to produce toxins (Use the following terminology in your answer: recombination, DNA, horizontal gene transfer, conjugation, transformation, transduction, pilus, F factor, transposable elements, transposons, pathogenicity islands)

Answers

Answer:

A) Propose two ways in which antibiotic resistance may develop in a bacterium?

Antibiotic resistance may develop in a bacterium through A GENETIC MUTATION and BY REQUIRING RESISTANCE FROM ANOTHER BACTERIUM

B.) Describe how bacterial cells acquire the ability to produce toxins?

The virulent strains of bacteria as in Corynebacterium diphtheria, and Streptococcus pyogenes all manufacture toxins with weighty physiological impacts, unlike the nonvirulent strains which do not manufacture toxins. The toxins are generated by a bacteriophage gene that has been received by transduction.

Using the knowledge of DNA recombination events to complete the -

two ways in which antibiotic resistance may developbacterial cells acquire the ability to produce toxins

1. Antibiotic resistance means some bacteria can grow and survive in the presence of one or more antibiotics like tetracycline, ampicillin, or others.  It can be developed by 1) horizontal gene transfer 2) Mutation

Horizontal gene transfer is a process that helps bacteria to transfer genes with each other.It is called horizontal gene transfer due to genetic exchange/ F factor, this process is also known as recombination.There are three methods of recombination: Conjugation, Transduction & Transformation.A mutation is a change in the genome of the organisms due to various reasons.  

2. Pathogenic bacteria may produce toxins. Toxins are of two types; exotoxins & endotoxins.

Exotoxin is released by lipopolysaccharides and protein which are associated with the bacterial cell wall.Endotoxins are associated with the structural mechanism of the bacterial cell. Pathogenicity islands are acquired by microorganisms by horizontal gene transfer.

Thus, the explanation is given above about the way resistance develops and the production of toxins.

Learn more:

https://brainly.com/question/12940685

Imagine that you are Gregor Mendel and you want to assure yourself that the F1 generation plants you generated from crossing true-breeding plantsactuallyare heterozygotes. You perform a testcross by mating all of your F1 smooth pea plants with plants that are homozygous recessive (wrinkled pea plants).

Answers

You should find another homozygous recessive if it it a homozygous dominate then you will not receive any recessive plants

In a study where participants rated the pleasantness of T-shirt odors, what gene alleles influenced their odor preference? a. Serotonin transporter b. Phosphatase enzyme c. Blood type d. Major histocompatibility complex

Answers

Answer:

Major histocompatibility complex

Explanation: In a variety of animals, including humans, there is a correlation between odor preference, and genetic similarity at the Major Histocompatibility Complex (MHC).

MHC is a highly polymorphic group of genes that play an important role in the immunological self/non self recognition. Its products have been recognised to take part on the numerous compounds and reactions that build up an individual's body odor.

Which of the following statements is/are accurate?
A. Horses and Mules can be bred but their offspring is typically sterile. This could be an example of hybrid breakdown.
B. One sponge species releases its gametes during the night and another species releases its gametes during the day. This is an example of ecological isolation
C. One species of sea turtle mates during the early spring and closely related species mates during late spring. This is an example of temporal isolation
D. One species of sea urchins can not fertilize another closely related species because the eggs do not have a receptor for the sperm. This is a good example of gametic isolation.
E. Damselflies have sensory receptors that are sensitive to touch (tactile cues). Two related species of damselflies are unable to mate because their touch cues are not compatibale. This is a good example of mechanical isolation.

Answers

Answer:

These statements refer to various mechanisms that act as a reproductive or hybridization barriers.

In nature there are different mechanisms that prevent the crossbreeding between different species, what in biology is called reproductive barriers. Some mechanisms that act by preventing hybridization between different species are:

Hybrid breakdownGametic isolation.Mecanical isolation.Temporal isolation.Ethological aislaminet.Ecological insulation.

These mechanisms are responsible for preserving the genetic integrity of each species by preventing hybridization between different species.

Explanation:

A. Horses and Mules can be bred but their offspring is typically sterile. This could be an example of a hybrid breakdown.

This is accurate. Horses and donkeys belong to two different species, with a different chromosomal load:

Horses have 32 pairs of chromosomes.Donkeys have 31 pairs of chromosomes.

Both species can be bred, but their descendant, mules (Equus africanus x ferus), have an odd number of chromosomes (63) and are infertile. This represents an exact example of hybrid breakdown.

B. One sponge species releases its gametes during the night and another species releases its gametes during the day. This is an example of ecological isolation.

This is not accurate. In sponges, like some coral species, periods of release of gametes and fertilization vary throughout the day, with some synchrony between individuals of the same species.

The fact that some sponges release their gametes by day and other species do it at night is an example of the reproductive barrier called temporal isolation.

C. One species of sea turtle mates during the early spring and a closely related species mates during late spring. This is an example of temporal isolation.

This is accurate. When two related but different species - such as turtles - have their mating period at different times of the year, there is talk of temporal or seasonal isolation.

Temporal isolation is a reproductive barrier that prevents crossing between different species, due to their mating habits at different times.

D. One species of sea urchins can not fertilize another closely related species because the eggs do not have a receptor for the sperm. This is a good example of a gametic isolation.

This statement is accurate. In the case of sea urchins, the encounter of gametes requires two chemical mechanisms:  

The first mechanism is called chemotaxis, which consists of the presence of a chemical signal on the surface of the egg, for which only sperm has a receptor.  Another mechanism is that - once the sperm and egg are found - the membrane of the egg releases substances that interact with receptors in the sperm, allowing the sperm to enter it.

These two chemical mechanisms ensure that gametes of two different species cannot be joined and fertilized, which is an example of gametic isolation.

E. Damselflies have sensory receptors that are sensitive to touch (tactile cues). Two related species of damselflies are unable to mate because their touch cues are not compatible. This is a good example of mechanical isolation.

This is accurate. The sensitivity to the touch of damselflies is specific to individuals of the same species, preventing mating between male and female of different species.

This, like courtship, is a mechanism that prevents crossbreeding between different species, establishing an example of mechanical isolation.

Learn more:

https://brainly.com/question/9277268

Some traits do not obey Mendel's law. For example, people with red hair tend to also have pale skin. Why might this be the case?

Answers

Answer: Polygenic inheritance

Explanation:

Polygenic inheritance is a phenomenon that explains how a character like skin color show a range of more or less continuous variation due to many genes controlling it. And this is unlike Mendel traits that are controlled by single genes.

So, skin color in an individual is expressed as red hair and pale skin.

Meselson and Stahl used density labeling of DNA to show that DNA replication occurs via a semiconservative mechanism. In their experiment, they started with an organism grown in a heavy density label (15N). After two generations of growth in light medium (the more common 14N isotope), if the DNA is isolated and separated by density, how many bands would be observed and how would their density compare with the starting DNA

Answers

Answer:

The organism previously used 15N for replication so all the DNA molecules were of 15N15N type. Then the organism is shifted to a medium where only 14N is available for replication. According to semi conservative mode of replication, a newly synthesised DNA molecule consists of one new strand and one parental strand. So after the first round of replication, All the 15N strands will synthesise new DNA strands using 14N resulting into intermediate 15N14N DNA molecules. Hence, only one band would be observed (15N14N) above the original 15N15N band since 15N14N has lighter isotope too so it will be lighter than 15N15N molecules and will lie above it.After second round of replication, 15N strand from 15N14N would synthesise another 14N strand. 14N strand from 15N14N molecules will also synthesise another 14N strand. So now, 50% of the DNA molecules will be of 15N14N intermediate type and 50% of them will be of 14N14N type.Two bands will be observed above the original 15N15N band. One band of 15N14N molecules will be right above it and other band of 14N14N molecules will be even higher because it is the lightest band since it has only the lighter isotope of nitrogen.

Final answer:

Two bands would be observed after isolation and ultracentrifugation of DNA from the Meselson and Stahl experiment following two generations in 14N: one intermediate density band (indicative of one 15N and one 14N strand) and one light density band (indicative of double 14N strands), proving semiconservative DNA replication.

Explanation:

In the Meselson and Stahl experiment which aimed to understand the mechanism of DNA replication, they observed the effects of consecutive generations of bacterial growth in media with different nitrogen isotopes. Initially, E. coli was grown in a heavy nitrogen isotope, 15N, followed by growth in a lighter isotope, 14N. After two generations in 14N, when the DNA was isolated and subjected to density gradient ultracentrifugation, two bands were observed. One band was of intermediate density, indicating it contained one 15N-labeled strand and one 14N-labeled strand. The second band was of lighter density, corresponding to DNA composed solely of 14N-labeled strands. This provided strong evidence for the semiconservative model of replication where each daughter DNA molecule consists of one parental and one new strand.

Other Questions
Demand for movie rentals is highly elastic. What will happen if a video store raises the price of a rental?It could possibly gain or lose revenue.It would see no change in revenue.It will lose revenueIt will gain revenue. Subtracting the inflation rate from the interest rate on a bond coupon allows for easy calculation of _____. Select the best answer from the choices provided. A. investment doubling times B. inflation effects C. default risk D. TIPS values Nargis is interested in running a business and decides to open a branch of a successful falafel shop that her sister owns in another town. In this case, Nargis could be best described as a _____. A 0.10-kilogram ball dropped vertically from a height of 1.0 meter above the floor bounces back to a height of 0.80 meter. The mechanical energy lost by the ball as it bounces is approximatelyA) 0.20 JB) 0.080 JC) 0.78 JD) 0.30 J )The diameter of the dart board is 50 centimeters. What is the approximate circumference? (Use 3.14 forA 157 cmB 78.5 cmcc 1962.5 cmD. 625 cmResetSubmit2 of 10 AnsweredSession Score:Session Timer: 5:04 9oType here to searchacer HELP ME HURRY definition: This is the structure of language and the rules that go with it. term: ? A 3-kW resistance heater in a water heater runs for 3 hours to raise the water temperature to the desired level. Determine the amount of electric energy used in both kWh and kJ. The amount of electricity used, in kWh, is kWh. The amount of electricity used, in kJ, is A small, solid sphere of mass 0.9 kg and radius 47 cm rolls without slipping along the track consisting of slope and loop-the-loop with radius 4.75 m at the end of the slope. It starts from rest near the top of the track at a height h, where h is large compared to 47 cm. If the g = 9.8 m/s^2 and I(solid sphere) = 2/5 mr^2, what is the minimum value of h such that the sphere completes the loop? Which of the following best describes the Industrial Revolution?a dramatic change in the way people worked and liveda revolt against the rule of kingsa new way of thinking about how hard people should worka change in the way European countries traded with other nations Which is true about rule utilitarianism and Kantianism (check all that apply) a. Both theories evaluate the moral rules in the same way b. According to both theories, right actions are those that are in line with universal moral rules c. Both are consequentialist theories d. Both are relativistic theories If a stranger looks like someone who previously harmed or threatened us in some way, we maywithout consciously recalling the earlier experiencereact warily. this illustrates that our reactions to others may be influenced by a. fixations. b. algorithms. c. intuition. d. overconfidence. Determine whether the relation R defined below is reflexive, irreflexive, symmetric, asymmetric, antisymmetric, or transitive. For each property, either explain why R has that property or give an example showing why it does not.a) Let A = {1, 2, 3, 4} and let R = { (2, 3) }b) Let A = {1, 2, 3, 4} and let R = { (1, 1), (1, 2), (1, 3), (2, 1), (2, 2), (2, 4), (3, 1), (3, 3), (4, 1), (4, 4) }. What was the aftermath of the Holocaust What material is most often used in carpeting?What are two functions of carpeting?In what room should you use the most expensive carpet in your home? Why? Marks car gets 30 miles per gallon for gas mileage. How many miles can Mark travel on 13 gallons of gas Enter your answer and shot all the steps that you use to solve this problem in the space provided. This diameter of a tire is 2.5 ft. Use this measurement to answer parts A and B. A - find the circumference of the tire. B - about how many times will the tire have to rotate to travel 1 mile? (1 mile = 5,280 ft)PLS HELP ASAP!! :)) WILL GIVE BRAINLIST Match the academic requirements with the careers :Tech programBachelors degreeHigh school diplomaCHOICES:equal opportunity officerCourt reporterSecurity officer one angle of a triangle has measure 26 degrees and another has measure 35 degrees. what is the measure, in degrees of the 3rd angle? Assume a bank has $5 million in deposits and $1 million in vault cash. If the bank holds $1 million in excess reserves and the required reserves ratio is 8 percent, what is the minimum required reserve? The first objective of _____ is to protect American consumers by ensuring that they benefit from products and ideas produced by foreign competitors as well as by domestic competitors.a. Antitrust lawsb. Intellectual property lawsc. Insurance lawsd. Indemnification lawse. Incorporation laws